MIR5739

MIR5739 Gene - GeneCards | MIR5739 RNA Gene

Complete information for MIR5739 gene (RNA Gene), MicroRNA 5739, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards ...

mir5739

102466081 - Gene ResultMIR5739 microRNA 5739 [ (human)]

MIR5739 microRNA 5739 [ (human)]. Gene ID: 102466081, updated on 12-Oct- 2019. Summary. microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs ...

mir5739

hsa-miR-5739

Description, Homo sapiens miR-5739 stem-loop. Literature search. 1 open access papers mention hsa-mir-5739 (2 sentences). Stem-loop, gg auaa - -a -a uugu ...

mir5739

MIR5739 (microRNA 5739)

MIR5739 (microRNA 5739), Authors: Dessen P. Published in: Atlas Genet Cytogenet Oncol Haematol.

mir5739

Human Gene MIR5739 (ENST00000619803.1) Description and ...

Description: Homo sapiens microRNA 5739 (MIR5739), microRNA. (from RefSeq NR_106713) RefSeq Summary (NR_106713): microRNAs (miRNAs) are short ...

mir5739

dbDEMC2

A database of differentially expressed miRNAs in human cancers (version 2.0)

mir5739

MIR5739 - microRNA 5739 - WikiGenes

The world's first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.

mir5739

MIR5739

MIR5739 Results. Genes 0 Matches; Conditions 0 Matches; Drugs 0 Matches. MIR5739 wasn't a match in our system. Please try a different or choose one of the  ...

mir5739

MIR5739 Symbol Report | HUGO Gene Nomenclature Committee

HGNC approved symbol report for the gene MIR5739 (HGNC_ID:49977)

mir5739

The hsa-miR-5739 modulates the endoglin network in endothelial ...

18 Nov 2011 ... The novel miRNA, hsa-miR-5739, was cloned and characterized its function and cellular expression in current study. The hsa-miR-5739 ...

mir5739

The hsa-miR-5739 modulates the endoglin network in endothelial ...

16 Nov 2019 ... The hsa-miR-5739 downregulated endothelial cells that were derived from human ES cells significantly suppressed the translational level of ...

mir5739

The hsa-miR-5739 modulates the endoglin network in endothelial ...

Abstract: MicroRNAs are small, noncoding RNAs that bind to seed sequences on the 3' untranslated regions of their target genes and then negatively regulate...

mir5739

hsa-miR-5739

mir5739

hsa-miR-5739

mir5739

Google Scholar

mir5739

Autism Database - CNV Search - AutDB

Summary Information. Deletions within this region were found in four cases from a study of 15,749 individuals from the International Standards for Cytogenomic ...

mir5739

mir5739

30

mm619, chr22:28,978,558-28,979,164, MIR5739-CHEK2, chr5:111,327,229- 111,327,790, Ttc28(intragenic), Negative. hs2240 · chr22:32,019,365-32,023,822  ...

mir5739

SomamiR DB

hsa-miR-5739, tCTCTCCGCcgccta, GCGGAGAG, m8a, (m8a->m7a), HHKTA_23537_NM_001014443|811|850|3.11529175572651| 0.873880877282829.

mir5739

Altered miRNA-profile dependent on ART outcome in early ...

significant alterations (miR-5001, miR-4632, miR-4327,. miR-5739 and miR-1249 ) between the two groups that were analyzed. As an example of such changes ...

mir5739

TATAA two-tailed miRNA assays - tataa

... miR-1909-3p (CGCAGGGGCCGGGUGCUCACCG); miR-5739 ( GCGGAGAGAGAAUGGGGAGC); miR-5001-5p ( AGGGCUGGACUCAGCGGCGGAGCU) ...

mir5739

MicroRNAs | HUGO Gene Nomenclature Committee

hsa-mir-5739. 22q12.1. HGNC:49930 · MIR5787. microRNA 5787. hsa-mir-5787. 3p21.31. HGNC:50261 · MIR6068. microRNA 6068. hsa-mir-6068. 1p31.3.

mir5739

table 1

7, miR-1224-5p, miR-20b-5p, miR-4534, miR-1260a, miR-4653-3p, miR-5739, miR-181b-5p. 8, miR-126-3p, miR-211-3p, miR-455-3p, miR-1260b, miR-466b- ...

mir5739

Altered Expressions of miR-1238-3p, miR-494, miR-6069, and miR ...

... 1.27, 0.4184, 2.65, 0.0418, −2.09, 0.1325. miR-5739, −1.14, 0.6948, 2.32, 0.0128, −2.65, 0.0144. miR-4433-5p, −1.37, 0.6996, −15.43, 0.0213, −11.26, 0.0411 ...

mir5739

pathway analysis

21, miR-5739, miR-4530, miR-34a, miR-5001, miR-15b, miR-196a. 22, miR-4459 , miR-5703, miR-3622b, miR-575, miR-16, miR-200. 23, miR-6087, miR-6088 ...

mir5739

23

mm619, chr22:28,978,558-28,979,164, MIR5739-CHEK2, chr5:111,327,229- 111,327,790, Ttc28(intragenic), Negative. mm621, chr22:27,972,469-27,973,657  ...

mir5739

Jung Ki Yoo | Semantic Scholar

The hsa-miR-5739 modulates the endoglin network in endothelial cells derived from human embryonic stem cells. Jung Ki Yoo, Jumi Kim, +4 authors Jin ...

mir5739

Supplemental Table 1

13, hsa-miR-5739, 0.043371384333519, 19. 14, hsa-miR-6073, 0.0521317538226647, 19. 15, hsa-miR-6723-5p, 0.0567606744359536, 19. 16, hsa-miR-6088 ...

mir5739

HHV-6A Infection of Endometrial Epithelial Cells Affects miRNA ...

1 Jan 2020 ... ... miR378a-3p, miR422, miR423-5p, miR424-5p, miR449a, miR517, miR572, miR575, miR1207-5p, miR3663-3p, miR4306 and miR5739.

mir5739

세포주발표논문 3 페이지 | 줄기세포 분양교육 시스템

201110, Biochem Biophys Res Commun, The hsa-miR-5739 modulates the endoglin network in endothelial cells derived from human embryonic stem cells ...

mir5739

Break Apart FISH Probes

The MIR5739 Break Apart FISH Probe is located on chromosome 22 at 22q12.1. This probe is sold in 20 test kits and can be custom labeled in 1 of 5 dye colors.

mir5739

List of miRNAs that were differently regulated between acute and ...

13 Jun 2019 ... 38, hsa-miR-5739, 2.82, 2.82, 0.3329, 15.99, 15.99, 0.0264, 0.18, -5.67, 0.1735. 39, hsa-miR-4532, 2.82, 2.82, 0.1706, 10.25, 10.25, 0.0304 ...

mir5739

Sheet1

58, hsa-miR-5739, 1.19881309160475, 0.0114755219475544. 59, hsa-miR- 1273g-3p, 1.18884538405138, 0.044712265391706. 60, hsa-miR-4649-5p ...

mir5739

Supplementary Online Material Table S1. Overview of studies from ...

hsa-miR-1273c, hsa-miR-4299, hsa-miR-5739, hsa-miR-6086, hsa-miR-494, hsa -miR-4270, hsa-miR-642a-3p, hsa-miR-4516, hsa-miR-4436a, hsa-miR-1246, ...

mir5739

MicroRNA profiles in various hepatocellular carcinoma cell lines

13 Jul 2019 ... Hepatocellular carcinoma (HCC) is one of the most common causes of cancer- associated mortality worldwide. Although surgery is considered ...

mir5739

Supplementary Information

miR-1233-5p MIMAT0022943. miR-1237-5p MIMAT0022946. miR-1238-5p MIMAT0022947. miR-4632-5p MIMAT0022977. miR-5739 MIMAT0023116.

mir5739

Integrated extracellular microRNA profiling for ovarian cancer ...

17 Oct 2019 ... ... this time identifying a different combination of ten miRNAs (miR-4687-3p, miR- 939-5p, miR-5739, miR-211-3p, miR-1273g-3p, miR-3663-3p, ...

mir5739

Chang-Hyun Kim - Publications

The hsa-miR-5739 modulates the endoglin network in endothelial cells derived from human embryonic stem cells. Biochemical and Biophysical Research ...

mir5739

miRNA mimics: hsa-miR-4801 to hsa-miR-6800 - miRNA | Sigma ...

HMI2191 · MISSION microRNA Mimic hsa-miR-5739. pricing. HMI2192 · MISSION microRNA Mimic hsa-miR-5787. pricing. HMI2200 · MISSION microRNA ...

mir5739

The Novel miR-7515 Decreases the Proliferation and Migration of ...

1 Jan 2013 ... The has-miR-5739 modulates the endoglin network in endothelial cells derived from human embryonic stem cells. Biochem Biophys Res ...

mir5739

Comments



Warning: file(keys/28.txt): failed to open stream: No such file or directory in /home/admin/web/vmi320931.contaboserver.net/public_html/theme/footer.php on line 50

Warning: shuffle() expects parameter 1 to be array, boolean given in /home/admin/web/vmi320931.contaboserver.net/public_html/theme/footer.php on line 51

Warning: Invalid argument supplied for foreach() in /home/admin/web/vmi320931.contaboserver.net/public_html/theme/footer.php on line 54


Subscribe neostinbuscompnas.ml